Elenco dei principali elementi HTML



Indici

Indice dei Tag in ordine alfabetico
Tag Description
!--...-- Defines a comment
!DOCTYPE> Defines the document type
a Defines a hyperlink
abbr Defines an abbreviation or an acronym
acronym Not supported in HTML5. Use <abbr> instead.
Defines an acronym
address Defines contact information for the author/owner of a document
applet Not supported in HTML5. Use <embed> or <object> instead.
Defines an embedded applet
area Defines an area inside an image-map
article Defines an article
aside Defines content aside from the page content
audio Defines sound content
b Defines bold text
base Specifies the base URL/target for all relative URLs in a document
basefont Not supported in HTML5. Use CSS instead.
Specifies a default color, size, and font for all text in a document.
bdi Isolates a part of text that might be formatted in a different direction from other text outside it
bdo Overrides the current text direction
big Not supported in HTML5. Use CSS instead.
Defines big text
blockquote Defines a section that is quoted from another source
body Defines the document's body
br Defines a single line break
button Defines a clickable button
canvas Used to draw graphics, on the fly, via scripting (usually JavaScript)
caption Defines a table caption
center Not supported in HTML5. Use CSS instead.
Defines centered text.
cite Defines the title of a work
code Defines a piece of computer code
col Specifies column properties for each column within a <colgroup> element
colgroup Specifies a group of one or more columns in a table for formatting
datalist Specifies a list of pre-defined options for input controls
dd Defines a description/value of a term in a description list
del Defines text that has been deleted from a document
details Defines additional details that the user can view or hide
dfn Represents the defining instance of a term
dialog Defines a dialog box or window
dir Not supported in HTML5. Use <ul> instead.
Defines a directory list.
div Defines a section in a document
dl Defines a description list
dt Defines a term/name in a description list
em Defines emphasized text
embed Defines a container for an external (non-HTML) application
fieldset Groups related elements in a form
figcaption Defines a caption for a <figure> element
figure Specifies self-contained content
font Not supported in HTML5. Use CSS instead.
Defines font, color, and size for text.
footer Defines a footer for a document or section
form Defines an HTML form for user input
frame Not supported in HTML5.
Defines a window (a frame) in a frameset.
frameset Not supported in HTML5.
Defines a set of frames.
h1 .. h6 Defines HTML headings
head Defines information about the document
header Defines a header for a document or section
hr Defines a thematic change in the content
html Defines the root of an HTML document
i Defines a part of text in an alternate voice or mood
iframe Defines an inline frame
img Defines an image
input Defines an input control
ins Defines a text that has been inserted into a document
kbd Defines keyboard input
label Defines a label for an <input> element
legend Defines a caption for a <fieldset> element
li Defines a list item
link Defines the relationship between a document and an external resource (most used to link to style sheets)
main Specifies the main content of a document
map Defines a client-side image-map
mark Defines marked/highlighted text
menu Defines a list/menu of commands
menuitem Defines a command/menu item that the user can invoke from a popup menu
meta Defines metadata about an HTML document
meter Defines a scalar measurement within a known range (a gauge)
nav Defines navigation links
noframes Not supported in HTML5.
Defines an alternate content for users that do not support frames.
noscript Defines an alternate content for users that do not support client-side scripts
object Defines an embedded object
ol Defines an ordered list
optgroup Defines a group of related options in a drop-down list
option Defines an option in a drop-down list
output Defines the result of a calculation
p Defines a paragraph
param Defines a parameter for an object
picture Defines a container for multiple image resources
pre Defines preformatted text
progress Represents the progress of a task
q Defines a short quotation
rp Defines what to show in browsers that do not support ruby annotations
rt Defines an explanation/pronunciation of characters (for East Asian typography)
ruby Defines a ruby annotation (for East Asian typography)
s Defines text that is no longer correct
samp Defines sample output from a computer program
script Defines a client-side script
section Defines a section in a document
select Defines a drop-down list
small Defines smaller text
source Defines multiple media resources for media elements (<video> and <audio>)
span Defines a section in a document
strike Not supported in HTML5. Use <del> or <s> instead.
Defines strikethrough text.
strong Defines important text
style Defines style information for a document
sub Defines subscripted text
summary Defines a visible heading for a <details> element
sup Defines superscripted text
table Defines a table
tbody Groups the body content in a table
td Defines a cell in a table
textarea Defines a multiline input control (text area)
tfoot Groups the footer content in a table
th Defines a header cell in a table
thead Groups the header content in a table
time Defines a date/time
title Defines a title for the document
tr Defines a row in a table
track Defines text tracks for media elements (<video> and <audio>)
tt Not supported in HTML5. Use CSS instead.
Defines teletype text.
u Defines text that should be stylistically different from normal text
ul Defines an unordered list
var Defines a variable
video Defines a video or movie
wbr Defines a possible line-break

Indice in base alla tipologia dei Tag
Basic HTML  
Tag Description
!DOCTYPE> Defines the document type
html Defines an HTML document
head Defines information about the document
title Defines a title for the document
body Defines the document's body
h1 - h6 Defines HTML headings
p Defines a paragraph
br Inserts a single line break
hr Defines a thematic change in the content
!--...-- Defines a comment
Formatting  
Tag Description
acronym Not supported in HTML5. Use <abbr> instead.
Defines an acronym
abbr Defines an abbreviation or an acronym
address Defines contact information for the author/owner of a document/article
b Defines bold text
bdi Isolates a part of text that might be formatted in a different direction from other text outside it
bdo Overrides the current text direction
big Not supported in HTML5. Use CSS instead.
Defines big text
blockquote Defines a section that is quoted from another source
center Not supported in HTML5. Use CSS instead.
Defines centered text.
cite Defines the title of a work
code Defines a piece of computer code
del Defines text that has been deleted from a document
dfn Represents the defining instance of a term
em Defines emphasized text
font Not supported in HTML5. Use CSS instead.
Defines font, color, and size for text.
i Defines a part of text in an alternate voice or mood
ins Defines a text that has been inserted into a document
kbd Defines keyboard input
mark Defines marked/highlighted text
meter Defines a scalar measurement within a known range (a gauge)
pre Defines preformatted text
progress Represents the progress of a task
q Defines a short quotation
rp Defines what to show in browsers that do not support ruby annotations
rt Defines an explanation/pronunciation of characters (for East Asian typography)
ruby Defines a ruby annotation (for East Asian typography)
s Defines text that is no longer correct
samp Defines sample output from a computer program
small Defines smaller text
strike Not supported in HTML5. Use <del> or <s> instead.
Defines strikethrough text.
strong Defines important text
sub Defines subscripted text
sup Defines superscripted text
time Defines a date/time
tt Not supported in HTML5. Use CSS instead.
Defines teletype text
u Defines text that should be stylistically different from normal text
var Defines a variable
wbr Defines a possible line-break
Forms and Input  
Tag Description
form Defines an HTML form for user input
input Defines an input control
textarea Defines a multiline input control (text area)
button Defines a clickable button
select Defines a drop-down list
optgroup Defines a group of related options in a drop-down list
option Defines an option in a drop-down list
label Defines a label for an <input> element
fieldset Groups related elements in a form
legend Defines a caption for a <fieldset> element
datalist Specifies a list of pre-defined options for input controls
output Defines the result of a calculation
Frames  
Tag Description
frame Not supported in HTML5.
Defines a window (a frame) in a frameset
frameset Not supported in HTML5.
Defines a set of frames
noframes Not supported in HTML5.
Defines an alternate content for users that do not support frames
iframe Defines an inline frame
Images  
Tag Description
img Defines an image
map Defines a client-side image-map
area Defines an area inside an image-map
canvas Used to draw graphics, on the fly, via scripting (usually JavaScript)
figcaption Defines a caption for a <figure> element
figure Specifies self-contained content
picture Defines a container for multiple image resources
Audio / Video  
Tag Description
audio Defines sound content
source Defines multiple media resources for media elements (<video>, <audio> and <picture>)
track Defines text tracks for media elements (<video> and <audio>)
video Defines a video or movie
Links  
Tag Description
a Defines a hyperlink
link Defines the relationship between a document and an external resource (most used to link to style sheets)
nav Defines navigation links
Lists  
Tag Description
ul Defines an unordered list
ol Defines an ordered list
li Defines a list item
dir Not supported in HTML5. Use <ul> instead.
Defines a directory list
dl Defines a description list
dt Defines a term/name in a description list
dd Defines a description of a term/name in a description list
menu Defines a list/menu of commands
menuitem Defines a command/menu item that the user can invoke from a popup menu
Tables  
Tag Description
table Defines a table
caption Defines a table caption
th Defines a header cell in a table
tr Defines a row in a table
td Defines a cell in a table
thead Groups the header content in a table
tbody Groups the body content in a table
tfoot Groups the footer content in a table
col Specifies column properties for each column within a <colgroup> element
colgroup Specifies a group of one or more columns in a table for formatting
Styles and Semantics  
Tag Description
style Defines style information for a document
div Defines a section in a document
span Defines a section in a document
header Defines a header for a document or section
footer Defines a footer for a document or section
main Specifies the main content of a document
section Defines a section in a document
article Defines an article
aside Defines content aside from the page content
details Defines additional details that the user can view or hide
dialog Defines a dialog box or window
summary Defines a visible heading for a <details> element
data Links the given content with a machine-readable translation
Meta Info  
Tag Description
head Defines information about the document
meta Defines metadata about an HTML document
base Specifies the base URL/target for all relative URLs in a document
basefont Not supported in HTML5. Use CSS instead.
Specifies a default color, size, and font for all text in a document
Programming  
Tag Description
script Defines a client-side script
noscript Defines an alternate content for users that do not support client-side scripts
applet Not supported in HTML5. Use <embed> or <object> instead.
Defines an embedded applet
embed Defines a container for an external (non-HTML) application
object Defines an embedded object
param Defines a parameter for an object

<!-- -->

Gli elementi  <!-- --> consentono di introdurre dei commenti nel testo HTML.
I commenti non saranno visualizzati dal browser.

I browser non mostrano i commenti HTML
<!-- Questo è un commento -->
I browser non mostrano i commenti HTML

<!DOCTYPE>

L'elemento <!DOCTYPE> individua il presente documento come HTML-5.

<a></a>

Gli elementi <a> denotano degli iperlink, cioè un collegamento (link) ad un'altra pagina Web.
L'attributo più importante degli elementi <a> è l'attributo href che consente di specificare la destinazione del link.
Generalmente il colore dei link cambia in conformità al loro utilizzo:
I link non ancora utilizzati (o visitati) sono di colore azzurro e sono sottolineati. Es. link.
I link già utilizzati sono di colore porpora e sono sottolineati. Es. link.
I link attivi (cioè sui quali si sta cliccando) sono di colore rosso e sono sottolineati. Es. link.

<a href="#Id_00">link</a> questo è un link.

<abbr></abbr>

Gli elementi <abbr> denotano le abbreviazioni, per finalità semantiche.

<abbr title="dottore">Dott.</abbr> Dott.

<acronym></acronym>

Gli elementi <acronym> denotano gli acronimi, per finalità semantiche.

<acronym title="Organizzazione delle Nazioni Unite">ONU </acronym>  ONU

<address></address>

Gli elementi <address> denotano gli indirizzi, per finalità semantiche.

<address>Mario Rossi<br>Corso Nigra, 60<br>10015-IVREA (TO)</address> 
Mario Rossi
Corso Nigra, 60
10015-IVREA (TO)


<area></area>

Gli elementi <area> individuano un'area attiva (cioè sensibile ai click) all'interno di una image-map.
Questi elementi erano molto usati agli inizi degli anni 2000, ma ora si preferisce impiegare al loro posto delle immagini SVG.
Vedi <map></map>.

<article>...</article>

Il tag <article> denota una porzione di testo indipendente e autonoma all'interno di un documento più vasto.
Gli elementi article, aside, footer, header e nav sono stati introdotti in HTML-5 allo scopo di standardizzare la nomenclatura utilizzata per indicare le aree in cui vengono tradizionalmente ripartite le pagine Web, rimpiazzando gli identificatori o le classi (non standard) che in HTML-4 erano già impiegate per lo stesso scopo.
Figura 1 - Elementi per la dedinizione dell'organizzazione delle pagine HTML
Si osservi che l'impiego dei suddetti elementi non è obbligatorio, tuttavia ci si aspetta che il loro uso semplifichi il lavoro dei browser che dovranno interpretare le pagine HTML ai fini della loro rappresentazione grafica.
Gli standard non forniscono alcuna indicazione circa la ripartizione degli articoli al loro interno, per cui volendo si potrebbero "nidificare" più elementi <article> uno dentro l'altro. Generalmente si preferisce però suddividere gli articoli in sezioni ricorrendo all'elemento <section>. Si osservi che queste ultime a loro volta potrebbero contenere a loro volta ulteriori sotto-sezioni o addirittura elementi <article>.

<aside>...</aside>

Gli elementi <aside> vengono solitamente impiegati per indicare le porzioni di testo collocate a sinistra o a destra dell'articolo (<article>) principale. Vedi Figura 1.

<audio>...</audio>

L'elemento <audio> individua una risorsa corrispondente ad una registrazione sonora rendendola fruibile, rendendo disponibile una interfaccia utente costituita di pulsanti di start, stop, regolazione del volume, eccetera.

<audio src="Elementi_HTML_files/horse.ogg" controls="controls">
<source                 src="Elementi_HTML_files/audio.ogg" type="audio/ogg"> Your browser does not support the audio element. </audio>


<b></b>

Gli elementi <b>, di cui ora si sconsiglia l'uso, venivano un tempo impiegati per evidenziare quei testi che si desiderava stampare in grassetto (bold). Oggi si suggerisce di usare i CSS o ricorrere agli elementi <strong></strong>.

<b>bold</b> bold
<strong>strong</strong>
strong

<base></base>

Il funzionamento dell'elemento <base> è in qualche modo simile a quello del comando "cd" di Linux o "CD" di MS-DOS, nel senso che consente di cambiare la directory di default considerata come punto di partenza quando occorre cercare un file.
Nel caso di HTML la prassi abituale prevede che il punto di partenza coincida "salvo indicazioni diverse" con  la directory di origine della pagina Web, ovvero con la directory dalla quale si è scaricato il file corrispondente alla pagina Web considerata.
Gli elementi <base> permettono di modificare il suddetto default specificando una diversa origine (URL di default) e il target di default per tutti i link di una pagina.

Ad esempio specificando:
 <base href="http://www.capralezioni.altervista.org/" target="_blank">
Tutti i link relativi vengono trasformati in link assoluti aventi come prefisso la URL indicata.
NOTA: all'interno di una pagina Web si può inserire al più un elemento <base> e questo deve obbligatoriamente risiedere all'interno dell'elemento <head>.

<big></big>

Gli elementi <big> denotano quelle porzioni di testo che debbono essere stampate con un carattere di forza maggiore (cioè più grande). Gli elementi <big> non sono più supportati da HTML-5 per cui se ne sconsiglia l'uso suggerendo di ricorrere ai CSS,

testo normale <big>testo ingrandito</big> testo normale testo ingrandito

Ufficialmente l'elemento <big></big> non è più supportato da HTML-5, ma è così diffuso che in pratica tutti i browser continuano a gestirlo.
Vedi anche: <small></small>.

<blockquote></blockquote>

Gli elementi <blockquote> denotano delle citazioni che si estendono su più righe.
L'attributo cite consente di rendere disponibile un riferimento, sotto forma di URL, al documento citato.

<blockquote cite="http://www.governo.it/costituzione-italiana/principi-fondamentali/2839">Art. 1
L'Italia è una Repubblica democratica, fondata sul lavoro.
La sovranità appartiene al popolo, che la esercita nelle forme e nei limiti della Costituzione.</blockquote>
Art. 1 L'Italia è una Repubblica democratica, fondata sul lavoro. La sovranità appartiene al popolo, che la esercita nelle forme e nei limiti della Costituzione.

Dovendo citare una singola frase si suggerisce di usare <q></q>.

<body></body>

Gli elementi <head> e <body> suddividono le pagine HTML in due sezioni denominate rispettivamente testa (<head>) e corpo (<body>).
I tag <body></body> racchiudono il testo della pagina Web nella sua interezza. Vedi anche <head></head>.

<br>

Gli elementi <br> vengono impiegati per segnalare l'interruzione di una linea di testo (line break) cioè la necessità di andare "a capo". Vedi anche <p></p>.

<button>

Gli elementi <button> consentono di introdurre dei pulsanti nell'interfaccia utente della pagina Web.
L'elemento <button> ha funzioni analoghe all'elemento <input type="button">  di cui si suggerisce l'utilizzo all'interno dei <form>.
Si osservi che anche l'elemento <button> è dotato dell'attributo type, nel caso specifico sono supportati i valori: button, submit e reset.
Vedi anche JS_04.

<button>Questo è un pulsante</button>

<canvas></canvas>

Gli elementi <canvas> consentono di allocare dei "contenitori" per delle bitmap utilizzabili per dipingere sullo schermo utilizzando delle procedure grafiche scritte in JavaScript.
Data la complessità dell'argomento si rimanda a xxx.

<caption></caption>

Gli elementi <caption> consentono associare una didascalia alle tabelle.

<table border="1">
  <caption>Spese Mensili</caption>
  <tr>
    <th>Mese</th>
    <th>Spese</th>
  </tr>
  <tr>
    <td>Gennaio</td>
    <td>100€</td>
  </tr>
  <tr>
    <td>Febbraio</td>
    <td>50€</td>
  </tr>
</table>


Spese Mensili
Mese Spese
Gennaio 100€
Febbraio 50€


<cite></cite>

Gli elementi <cite> denotano delle citazioni, per finalità semantiche.

<cite>Nel mezzo del cammin di nostra vita...</cite> Nel mezzo del cammin di nostra vita...

<code></code>

Gli elementi <code> sono impiegati per evidenziare quei i frammenti di codice programma inseriti nelle pagine HTML a titolo di esempio.

<code>code</code> code

<data></data>

Gli elementi <data> consentono di associare dei dati (leggibili dai bot) a particolari ad un qualsiasi elemento HTML. Utilizzato per finalità semantiche.

 <ul>
  <li><data value="101">Vaniglia</data></li>
  <li><data value="102">Pistacchio</data></li>
  <li><data value="103">Fragola</data></li>
</ul>
  • Vaniglia
  • Pistacchio
  • Fragola

<datalist>...</datalist>

Gli elementi <datalist> consentono di specificare una lista di opzioni predefinite utilizzabili in combinazione con gli elementi <input type="list">. Si osservi che il valore dell'attributo list dell'elemento <input> deve coincidere con l'id della <datalist> associata.

<input list="Id_Disney" placeholder="Pippo" type="list"><br>
<datalist id="Id_Disney">
  <option selected="selected" value="Topolino"></option>
  <option value="Minnie"></option>
  <option value="Paperino"></option>
</datalist>



<del></del>

Gli elementi <del> sono usati generalmente in combinazione con gli elementi <ins></ins>, per finalità semantiche, allo scopo di evidenziare le variazioni introdotte in un testo mostrando la situazione prima e dopo le modifiche.
La semplice presenza di una porzione di testo obsoleta può invece essere evidenziata per mezzo del tag <s></s>.

Ti <del>amo</del> <ins>odio</ins>! Ti amo odio!

<details>...</details>

Gli elementi <summary></summary> vengono utilizzati in combinazioni con gli elementi <details></details>.. allo scopo di creare delle porzioni di testo a scomparsa, cioè normalmente nascoste, fatto salvo per un breve riassunto contenuto all'interno degli elementi <summary></summary>, che però possono essere espanse cliccando sul segno corrispondente al triangolino.

<details>
<summary style="color:red;">Cliccare sul triangolino per espandere il testo</summary>
Il testo "a scomparsa" normalmente nascosto può essere espanso cliccando sul triangolino.
</details>

Cliccare sul triangolino per espandere il testo Il testo "a scomparsa" normalmente nascosto può essere espanso cliccando sul triangolino.


Vedi: <summary></summary>.

<dfn></dfn>

Gli elementi <dfn> evidenziano le definizioni introdotte nel testo, per finalità semantiche.

<dfn>Nella geometria piana ? viene definito come il rapporto tra la lunghezza della circonferenza e il corrispondente diametro.</dfn> Nella geometria piana ? viene definito come il rapporto tra la lunghezza della circonferenza e il corrispondente diametro.

<div></div>

Gli elementi <div> sono usati come "contenitori" per organizzare i blocchi di testo dal punto di vista grafico e semantico.
I <div> acquisiscono le loro proprietà grafiche attraverso l'attributo style o i CSS.

<dialogue></dialogue>

Gli elementi <dialogue> è stato introdotto allo scopo di facilitare lo sviluppo di finestre di dialogo (dialogue-box).
Sfortunatamente l'elemento è supportato da pochi browser, per cui in alternativa si consiglia il ricorso all'attributo hidden.

<dl></dl>

Gli elementi <dl> sono usati in combinazione con gli elementi <dd> e <dt> allo scopo di definire delle liste indentate.
I tag <dt> definiscono delle tipologie e i tag <dd> delle categorie più specifiche.

<dl>
<dt>Pastore</dt>

<dd>dei Pirenei</dd>
<dd>Scozzese</dd>
<dd>Tedesco</dd>
<dt>Gatto</dt>
<dd>Soriano</dd>
</dl>
Pastore
dei Pirenei
Scozzese
Tedesco
Gatto
Soriano


<em></em>

Gli elementi <em> vengono impiegati per enfatizzare (empathize) i testi stampandoli in corsivo (italic).
Dal punto di vista grafico il risultato è simile a quello che si ottiene ricorrendo ai tag <i>..</i>.
Scrivendo pagine HTML-5, volendo evidenziare un testo usando il corsivo, si suggerisce di limitare i ricorso ai  tag <i>..</i>, poiché questi ultimi hanno una valenza prettamente grafica, dando la preferenza ai tag <em></em>.

<i>italic</i> italic
<em>em</em>
em

<embed>

L'elemento <embed>viene impiegato come "contenitore" per un plug-in o un applicazione esterna.
Un caso tipico è costituito dal ricorso all'elemento <embed> allo scopo di includere all'interno di una pagina Web un'immagine rappresentata in un formato non standard, cioè in un formato normalmente non supportato dai browser (come il formato TIF o un tempo il formato SVG)

<embed src="Elementi_HTML_files/svg_logo.svg">


<fieldset>...</fieldset>

L'elemento <fieldset> consente di raggruppare un insieme di elementi (spesso elementi <input> di un form) circondandoli con un filetto.

<form>
  <fieldset>
    <legend>Login:</legend>
   
User Name: <input type="text"><br>
    Password: <input type="password"><br>
  </fieldset>
</form>

Login: User Name:
Password:


<figcaption>...</figcaption>

L'elemento <figcaption> individua la didascalia di una illustrazione (vedi esempio in <figure>).

<figure>...</figure>

L'elemento <figure> permette di raggruppare tutti gli elementi HTML attinenti ad una illustrazione o una risorsa multimediale comprese le didascalie ed eventuali bordi.

<figure class="Cl_Center"> <img src="JS_02_files/calcolatrice_XP.jpg"> <figcaption>Figura 3 - La calcolatrice di Windows-XP</figcaption> </figure>
Figura 3 - La calcolatrice di Windows-XP


<form>...</form>

L'elemento <form> viene utilizzato come contenitore allo scopo di creare un modulo di input HTML.
L'elemento <form> tipicamente conterrà uno o più dei seguenti elementi:
  • <input>
  • <textarea>
  • <button>
  • <select>
  • <option>
  • <optgroup>
  • <fieldset>
  • <label>.
Vedi Input elements & Form.

<h1></h1>

Gli elementi <h1>..<hn> consentono di applicare ad un testo di una o più righe gli stili dei titoli (header).
<h1>Heading-1 (Times-24)</h1>
<h2>Heading-2 (Times-18)</h2>
<h3>Heading-3 (Times-14)</h3>
<h4>Heading-4 (Times-12)</h4>
<h5>Heading-5 (Times-10)</h5>
<h6>Heading-6 (Times-8) </h6>

Heading-1 (Times-24)

Heading-2 (Times-18)

Heading-3 (Times-14)

Heading-4 (Times-12)

Heading-5 (Times-10)
Heading-6 (Times-8)

<head></head>

Gli elementi <head> e <body> suddividono le pagine HTML in due sezioni denominate rispettivamente testa (<head>) e corpo (<body>).
I tag <head></head> definiscono un contenitore utilizzato per includere tutti gli elementi di testa ed in particolare: l'elemento <title>, i metadati (elementi <meta>) e l'elemento <style>. Vedi anche <body></body>.

<header>...</header>

L'elemento <header> da non confondere con l'elemento <head> individua il blocco, solitamente posto in alto all'inizio della pagina Web, che costituisce l'intestazione della pagina Web. Blocco che solitamente contiene il nome del sito Web, il logo, eccetera. Vedi Figura 1.

<hr>

L'elemento <hr> visualizza una linea orizzontale utilizzabile per spezzate il testo in sezioni distinte.

prima<hr>dopo prima
dopo

<html>...</html>

I tag <html></html> svolgono tre funzioni:
informano i browser che il documento esaminato è una pagina HTML,
rappresentano la radice (root) del DOM,
assolvono la funzione di "contenitore" per tutti gli elementi HTML, con la sola eccezione del tag <!DOCTYPE>.
L'elemento <html> è suddiviso in due sezioni corrispondenti all'elemento <head> e all'elemento <body> che corrispondono rispettivamente all'intestazione (dichiarazione dei metadati) e al testo del documento vero e proprio.

<!DOCTYPE html>
<html lang="it">
  <head>
    <meta content="text/html; charset=utf-8" http-equiv="content-type">
    <title></title>
    <meta content="Luigi D. CAPRA" name="author">
    <meta content="BlueGriffon wysiwyg editor" name="generator">
  </head>
  <body>
    <p><br>
    </p>
  </body>
</html>


<i></i>

Gli elementi <i>, di cui ora si sconsiglia l'uso, venivano un tempo impiegati per evidenziare quei testi che si desiderava stampare in corsivo (italic). Oggi si suggerisce di usare gli elementi <em></em>.

<i>italic</i> italic
<em>em</em>
em

<iframe>..</iframe>

Gli elementi <iframe>..</iframe> consentono di includere (embed) un altro documento (eventualmente in'altra pagina HTML) all'interno della pagina HTML corrente.
Gli <iframe> sostituiscono gli elementi <frame> che sono stati dichiarati obsoleti perché presentavano dei problemi di sicurezza.




<img></img>

Gli elementi <img> consentono di introdurre delle immagini all'interno delle pagine HTML.
Gli elementi <input> sono caratterizzati da due attributi obbligatori src e alt, il primo dei quali permette di indicare la URL corrispondente alla immagine che si desidera visualizzare, mentre il secondo consente di specificare un testo da mostrare nel caso in cui l'immagine cui si fa riferimento non sia disponibile (perché non può essere letta o è di formato incompatibile).

<img alt="testo alternativo" src="immagine1.jpg">

<input>

Gli elementi <input> denotano le caselle di input presenti negli elementi <form>.
Poiché si tratta di un argomento vasto e complesso si rimanda al capitolo ad essi dedicato. Vedi Input elements & Form

<ins></ins>

Gli elementi <ins> sono usati generalmente in combinazione con gli elementi <del></del>, per finalità semantiche, allo scopo di evidenziare le variazioni introdotte in un testo mostrando la situazione prima e dopo le modifiche.
La semplice presenza di una porzione di testo obsoleta può invece essere evidenziata per mezzo del tag <s></s>.

Ti <del>amo</del> <ins>odio</ins>! Ti amo odio!

<kbd>..</kbd>

Gli elementi <kbd> denotano il testo che dovrebbe essere introdotto da tastiera. Si sconsiglia l'impiego dei tag <kbd>.

<kbd>testo che dovrebbe essere digitato</kbd> testo che dovrebbe essere digitato

<label>

Etichette di input.
Gli elementi <label>, sebbene indistinguibili dal normale testo, per quanto concerne la grafica, complementano ed estendono le caselle di input ad essi associati, facilitandone la selezione.
Quando un elemento <label> associato ad un particolare elemento <input> è possibile selezionare la casella di input cliccando indifferentemente su quest'ultima o sulla corrispondente etichetta (<label>).
Il legame fra etichette e caselle di input si stabilisce assegnando all'attributo for degli elementi <label> il valore dell'id che contraddistingue la casella di input considerata.

<form action="/action_page.php">
<label for="uomo">Male</label>
<input type="radio" name="genere" id="uomo" value="male"><br>
<label for="donna">Female</label>
<input type="radio" name="genere" id="donna" value="female"><br>
<input type="submit" value="Submit">
</form>




<legend>...</legend>

L'elemento <legend> viene usato allo scopo di specificare le didascalie degli elementi <fieldset>.

<form>
  <fieldset>
    <legend>Login:</legend>
   
User Name: <input type="text"><br>
    Password: <input type="password"><br>
  </fieldset>
</form>

Login: User Name:
Password:


<li>...</li>

Gli elementi <li> denotano le voci elencate nelle liste.
Gli elementi <li> possono essere impiegati in combinazione con le liste ordinate (ordered list <ol>) e non ordinate (un-ordered list <ul>).

ordinato<br>
<ol>
  <li>primo</li>
  <li>secondo</li>
  <li>terzo</li>
</ol>
<br>
non ordinato<br>
<ul>
  <li>verde</li>
  <li>bianco</li>
  <li>rosso</li>
</ul>
ordinato
  1. primo
  2. secondo
  3. terzo

non ordinato
  • verde
  • bianco
  • rosso

Vedi anche <ol></ol> e <ul></ul>.

<main>...</main>

L'elemento <main> individua il contenuto principale di una pagina Web.
Il contenuto all'interno dell'elemento <main> idealmente dovrebbe essere univoco. Non deve cioè contenere contenuti  stereotipati che si desidera riutilizzare in altri documenti come ad esempio: barre laterali (aside), barre di navigazione (nav), eccetera.
Si osservi che:
Non si può includere più di un elemento <main> per ciascun documento.
Facendo riferimento al DOM, l'elemento <main> NON può essere discendente di alcuno degli elementi: <article>, <aside>, <nav>, <footer>, <header> (cioè non può essere "contenuto" al loro interno).

<map>...</map>

Gli elementi <map></map> concentono di definire una mappa-immagine (image-map) lato client, cioè di associare una mappa cliccabile ad una immagine definendo un insieme di aree sensibili.
Ancora una volta per stabilire una relazione fra l'immagine e la mappa si ricorre agli attributi facendo coincidere l'attributo name dell'elemento <map> coincidente con l'attributo usemap della corrispondente <img>.
Molto popolari fino ad una decina di anni fa, gli elementi <map></map> stanno oggi cadendo in disuso a favore di tecniche basate sull'utilizzo delle immagini in formato SVG, che consentono di ottenere risultati molto più spettacolari ed efficaci.
Vedi anche <area></area>.

<mark>...</mark>

Gli elementi <mark> denotano quegli elementi che debbono essere evidenziati come se si fosse usato il pennarello evidenziatore.

<mark>Mark</mark> Mark

<menu>...</menu>

Gli elementi <menu></menu> definiscono l'elenco delle voci di un menu di comandi.
Il tag <menu> ha avuto un curioso destino: dichiarato obsoleto una decina di anni fa è stato poi "ripescato" e ridefinito in modo diverso. Attualmente l'elemento <menu> viene usato per i menu contestuali, le barre degli strumenti e per elencare i controlli e i comandi del modulo.

<div style="background:yellow;border:1px solid yellow; padding: 10px;"
  contextmenu="mymenu">
  <p>Cliccando nell'area evidenziata in giallo con il tasto <span style="font-weight: bold;">destro </span>del
  <spanstyle="font-style: italic;">mouse </span>vedrete aprirsi un menu arricchito di funzionalità aggiuntive.</p>
  <menu type="context" id="mymenu">
    <menuitem label="Refresh" onclick="window.location.reload();" icon="ico_reload.png">
  </menuitem>
  <menu label="Share on...">
    <menuitem label="Twitter" icon="ico_twitter.png" onclick="window.open('//twitter.com/intent/tweet?text=' + window.location.href);">
    </menuitem>
    <menuitem label="Facebook" icon="ico_facebook.png" onclick="window.open('//facebook.com/sharer/sharer.php?u=' + window.location.href);">
    </menuitem> </menu>
    <menuitem label="Email This Page" onclick="window.location='mailto:?body='+window.location.href;">
    </menuitem>
  </menu>
</div>


Cliccando nell'area evidenziata in giallo con il tasto destro del mouse vedrete aprirsi un menu arricchito di funzionalità aggiuntive.



NB: attualmente gli elementi <menu> sono supportati solo da Mozilla Firefox.

<menuitem>...</menuitem>

Gli elementi <menuitem></menuitem> denotano le voci (item) dei popup menu invocabili cliccando con il tasto destro del mouse su di particolari aree. Vedi <menu></menu>.

<meta>...</meta>

Gli elementi <meta> consentono di associare dei metadati alla pagina Web; questi ultimi sono individuati in base al loro nome
ovvero al valore dell'attributo name; al metadato specificato verrà assegnato il valore dell'attributo content.
Ad esempio l'elemento:
<meta content="scheda_prodotto, Fiat Panda" name="keywords">
Assegna le chiavi "scheda_prodotto" e "Fiat Panda" al metadato "keywords" allo scopo di facilitare il lavoro dei motori di ricerca.

<meter>...</meter>

L'elemento <meter> è stato introdotto allo scopo di essere utilizzato come indicatore per visualizzare una misura generica.
Nel caso in cui si volesse visualizzare lo stato di avanzamento di un processo si consiglia di utilizzare l'elemento <progress>.

<meter optimum="70" min="0" max="100" value="35"> </meter>



<nav>...</nav>

L'elemento <nav> individua solitamente il blocco corrispondente ai menu ovvero dalle liste delle voci che consentono di navigare all'interno delle pagine che costituiscono il sito Web. Vedi Figura 1.
Si osservi che l'elemento <nav> può essere disposto sia in orizzontale (come in Figura 1) che in verticale in maniera analoga agli elementi aside.

<noscript>...</noscript>

Gli elementi <noscript> consentono di introdurre un testo alternativo da visualizzare nel caso in cui gli utenti abbiano disabilitato il linguaggio di script o nel caso in cui il browser considerato non lo supporti.
L'elemento <noscript> può essere utilizzato sia all'interno di <head> che di <body>.

<object>...</object>

Gli elementi <object></object> consentono di includere degli "oggetti" (risorse o altri documenti) all'interno delle pagine HTML. In particolare il tag <object> può essere utilizzato per incorporare contenuti multimediali (come audio, video, applet Java, ActiveX, PDF e Flash) nelle pagine Web.
Il tag <object> può anche essere impiegato per incorporare altre pagina web nel documento HTML.
Nel caso in cui fosse necessario passare dei parametri al documento integrato, tale risultato può essere ottenuto ricorrendpo agli elementi <param></param>.

<ol>...</ol>

Gli elementi <ol></ol> permettono di includere delle liste ordinate all'interno della pagina Web.
Le liste possono essere ordinate numericamente o alfabeticamente.
Vedi anche <li></li> e <ul></ul>.

<optgroup>...</optgroup>

Gli elementi <optgroup></optgroup> vengono impiegati all'interno degli elementi <select></select> allo scopo di consentire l'aggregazione delle opzioni (<option></option>) permettendo la creazione di liste strutturate su più livelli.
Vedi anche: <option></option> e <select></select>..

<select name="Nm_Color3" size="1">
<optgroup label="Colori caldi
">
<option>Rosso </option>

<option>Giallo </option>
<option>Arancio</option>
</optgroup>
<optgroup label="Colori freddi">
<option>Verde </option>
<option>Blue </option>
<option>Viola</option>

</optgroup>
</select>



<option>...</option>

Gli elementi <option></option> specificano le opzioni offerte dagli elementi <select></select>.
Vedi anche: <optgroup></optgroup> e <select></select>.

<select name="Nm_Color2" size="1">
  <option selected="selected" value="0">Bianco </option>
  <option value="1">Rosso </option>
  <option value="2">Verde </option>
  <option value="3">Blue </option>
  <option value="4">Giallo </option>
  <option value="5">Nero </option>
</select>


<output>...</output>

L'elemento <output> visualizza il valore della variabile associata al suo variare.

<form oninput="Id_02.value=parseInt(Id_00.value)+parseInt(Id_01.value)">0
  <input id="Id_00" min="0" max="100" value="50" type="range"> +
  <input id="Id_01" min="0" max="100" value="50" type="number"> =
  <output name="Id_02"></output>
</form>

0 + =

<p>...</p>

L'elemento paragraph <p> individua i paragrafi intesi come linee di testo non interrotte da punti. Dovrebbe pertanto essere uno degli elementi più comuni nelle pagine HTML-5, anche se molti continuano a limitarsi a marcare il fine riga con il tag di "a capo" <br>.
La differenza fra i tag <br> e <p> consiste nel fatto che il primo si limita a segnalare la necessità di andare a capo per fini grafici mentre il secondo delimita logicamente i paragrafi. Vedi anche <br>.

<param>

Gli elementi <param> vengono comunemente utilizzati in combinazione con gli elementi <object></object> allo scopo di passare dei parametri ai plug-in integrati.

<picture>...</picture>

Gli elementi <picture> sono stati introdotti in HTML-5 allo scopo di offrire un controllo più fine sulle immagini presenti all'interno della pagina.

<pre></pre>

Gli elementi <pre> denotano i testi preformattati. Il testo degli elementi <pre> viene visualizzato in un font a larghezza fissa (tipicamente Courier)allo scopo di conservare l'allineamento delle colonne dei caratteri e i fine riga.

mele        1,5  kg  1,75
prosciutto  1,0  hg  1,20
mortadella  2,0  hg  2,00
pane comune 2,5  kg  3,20

totale               8,15
mele        1,5  kg  1,75
prosciutto  1,0  hg  1,20
mortadella  2,0  hg  2,00
pane comune 2,5  kg  3,20

totale               8,15

<progress>...</progress>

L'elemento <progress> può essere usato per indicare lo stato di avanzamento di un processo (ad esempio il caricamento di un file).

<progress  form="100" max="100" value="70"> </progress>


<q>...</q>

L'elemento <q> evidenzia una citazione corta.
Nel caso di citazioni lunghe si suggerisce di usare <blockquote></blockquote>.

<q>In quel ramo del lago di Como...</q>
In quel ramo del lago di Como...

<rp>...</rp>

L'elemento <rp></rp> evidenzia un'annotazione Ruby priva di parentesi.
Vedi <ruby></ruby>.

<rt>...</rt>

L'elemento <rt></rt> definisce una precisazione circa la pronunzia dei caratteri di una citazione in giapponese.
Vedi <ruby></ruby>.

<ruby>...</ruby>

L'elemento <ruby></ruby> evidenzia la presenza di un'annotazione Ruby.
Usato per commentare le pagine Web in giapponese.

<s>...</s>

Gli elementi <s> (strikethrough) consentono di evidenziare quelle frasi o porzioni di testo che non sono più rilevanti, accurate, oppure che sono diventate obsolete. il tutto per finalità semantiche,
Nel caso in cui si desideri evidenziare i cambiamenti introdotti nel testo mostrando la situazione prima e dopo si consiglia di avvalersi dei tag <del></del> e <ins></ins>.

<s>testo obsoleto</s>
testo obsoleto

<samp>...</samp>

Gli elementi <sample></sample> consentono di evidenziare, per finalità semantiche, porzioni dell'output di un'applicazione introdotte all'interno della pagina Web a titolo di esempio.
Si veda anche <kbd></kbd> per quanto concerne l'input da riga di comando e <code></code> circa il codice sorgente.

<samp>Microsoft Windows [Versione 10.0.15063]
(c) 2017 Microsoft Corporation. Tutti i diritti sono riservati.

D:\>dir
 Il volume nell'unità D è DATA
 Numero di serie del volume: E072-28B1

 Directory di D:\

01/12/2017  15:38    <DIR>          .
01/12/2017  15:38    <DIR>          ..
18/08/2015  16:48            13.889 horse.ogg
02/12/2017  10:17            12.437 html_org.svg
01/12/2017  15:35             1.604 svg_logo.svg
21/11/2017  14:24            20.326 video.jpg
18/08/2015  17:49           788.493 video.mp4
               5 File        836.749 byte
               2 Directory  187.405.848.576 byte disponibili

D:>
<samp>
Microsoft Windows [Versione 10.0.15063] (c) 2017 Microsoft Corporation. Tutti i diritti sono riservati. D:\>dir Il volume nell'unità D è DATA Numero di serie del volume: E072-28B1 Directory di D:\ 01/12/2017 15:38 . 01/12/2017 15:38 .. 18/08/2015 16:48 13.889 horse.ogg 02/12/2017 10:17 12.437 html_org.svg 01/12/2017 15:35 1.604 svg_logo.svg 21/11/2017 14:24 20.326 video.jpg 18/08/2015 17:49 788.493 video.mp4 5 File 836.749 byte 2 Directory 187.405.848.576 byte disponibili D:>

<script>...</script>

Gli elementi <script></script> sono dei "contenitori" utilizzati per inglobare dei frammenti di codice (tipicamente  JavaScript).
Gli elementi <script> permettono sia di includere direttamente il codice programma che di far riferimento ad un file esterno contenente i sorgenti delle routine cui si fa riferimento.
Nel primo caso (ricorrendo a codice Javascript) la sintassi è molto semplice in quanto basta scrivere il codice desiderato fra i tag.
Ad esempio:
<script type="text/javascript">
alert("Questo finestra viene visualizzata usando JavaScript.");
</script>


Nel secondo caso si farà ricorso all'attributo src per forzare il caricamento della pagina di codice specificata come valore.
Ad esempio:
<script type="text/javascript" src="my_script.js"></script>

<section>...</section>

Le sezioni sono le unità di testo in cui è possibile scomporre un articolo (<article>).
Le sezioni sono normalmente intese come unità di testo dotate di una semantica interna coerente ed auto sufficiente, per cui è consentito (al browser) spostarle all'interno della pagina senza che il significato del testo risulti compromesso (vedi Figura 1).

<select>...</select>

Gli elementi <select></select> sengono usati in combinazione con gli elementi <option></option> allo scopo di creare delle liste a discesa (drop-down list).

<select name="Nm_Color2" size="1">
  <option selected="selected" value="0">Bianco </option>
  <option value="1">Rosso </option>
  <option value="2">Verde </option>
  <option value="3">Blue </option>
  <option value="4">Giallo </option>
  <option value="5">Nero </option>
</select>



Vedi anche: <option></option> e <optgroup></optgroup>.

<small></small>

Gli elementi <small> denotano quelle porzioni di testo che debbono essere stampate con un carattere di forza minore (cioè più piccoli). Gli elementi <small> non sono più supportati da HTML-5 per cui se ne sconsiglia l'uso suggerendo di ricorrere ai CSS,

testo normale <small>small</small> testo normale small

Vedi anche: <big></big>.

<source>...</source>

Gli elementi <source></source> consente di specificare più risorse per gli elementi multimediali, come <video>, <audio> e <picture>.
Ricorrendo al tag <source> si possono specificare file vide, audio
o immagine alternativi tra i quali il browser può scegliere allo scopo di ottimizzare la presentazione grafica in funzione del tipo di supporto, dei codec o della tipologia di query multimediale.

<audio controls>
<source src="mameli.ogg" type="audio/ogg">
<source src="
mameli.mp3" type="audio/mpeg">
Il vostro browser non supporta gli elementi audio.
</audio>



<span></span>

Gli elementi <span> sono usati come "contenitori" per raggruppare e organizzare frammenti di linea di testo dal punto di vista grafico e semantico.  Gli elementi <span> acquisiscono le loro proprietà grafiche attraverso l'attributo style o i CSS.
Gli elementi <span> debitamente "decorati" con i corrispettivi attributi id possono essere utilizzati come punti di aggancio per collegare delle porzioni di testo lineare generate dinamicamente.

<strike></strike>

Gli elementi <strike> consentono di barrare un testo a metà altezza.
Gli elementi <strike> non sono supportati da HTML-5. Al loro posto si consigli di ricorrere ai CSS oppure agli elementi semantici <del></del> o <s></s>.

<strike>strike</strike> strike

<strong></strong>

Gli elementi <strong> sono impiegati per evidenziare quei testi che si desidera porre particolarmente in risalto stampandoli in grassetto (bold).

<b>bold</b> bold
<strong>strong</strong>
strong

<style>...</style>

Gli elementi <style></style> sono dei "contenitori" utilizzabili allo scopo di includere le informazioni di stile all'interno della pagina Web riunendole nell'intestazione (<elemento <head>)

<sub>...</sub>

Gli elementi <sub></sub> consentono di evidenziare quelle porzioni di testo che debbono essere visualizzate come pedici.

H<sub>2</sub>O
H2O

<summary>...</summary>

Gli elementi <summary></summary> vengono utilizzati in combinazioni con gli elementi <details></details>.. allo scopo di creare delle porzioni di testo a scomparsa, cioè normalmente nascoste, fatto salvo per un breve riassunto contenuto all'interno degli elementi <summary></summary>, che però possono essere espanse cliccando sul segno corrispondente al triangolino.

<details>
<summary style="color:red;">Cliccare sul triangolino per espandere il testo</summary>
Il testo "a scomparsa" normalmente nascosto può essere espanso cliccando sul tringolino.
</details>

Cliccare sul triangolino per espandere il testo Il testo "a scomparsa" normalmente nascosto può essere espanso cliccando sul tringolino.


Vedi: <details></details>.

<sub>...</sub>

Gli elementi <sup></sup> consentono di evidenziare quelle porzioni di testo che debbono essere visualizzate come apici.

2<sup>3</sup>=8
23=8

<table>...</table>

Gli elementi <table></table> definiscono le tabelle HTML.
Le tabella HTML sono  costituita dall'elemento <table> e da uno o più elementi <tr>, <th> e <td>.
Gli elementi <tr> definiscono le righe delle tabelle,
gli elementi <th> definiscono le intestazioni (header) delle tabelle mentre gli elementi <td> definiscono le celle che costituiscono le colonne della tabella.
Si possono definire anche delle tabelle più complesse che possono includere gli elementi: <caption>, <col>, <colgroup>, <thead>, <tfoot> e <tbody>.


<table style="width: 100%" border="1">
<thead>
<tr>
<th>merce</th>
<th>costo</th>
</tr>       
</thead>
<tbody>
<tr>
<td>arance 1 kg</td>
<td>1,00</td>
</tr>
<tr>
<td>limoni 1 kg</td>
<td>1,20</td>
</tr>
<tr>
<td>mele 2 kg</td>
<td>2,15</td>
</tr>
</tbody>
<tfoot>
<tr>
<td>totale</td>
<td>4,35</td>
</tr>
</tfoot>
</table>

merce costo
arance 1 kg 1,00
limoni 1 kg 1,20
mele 2 kg 2,15
totale 4,35


<textarea>...</textarea>

Gli elementi <textarea></textarea> definiscono delle aree dedicate all'editing ti testi costituiti da più linee.
Le aree di testo "multilinea" possono contenere un numero illimitato di caratteri.
Il testo viene visualizzato tipicamente utilizzando font a larghezza fissa come il Courier.

Le dimensioni dell'area di testo sono determinate dai valori degli attributi cols e rows, oppure attraverso le proprietà di altezza
(height) e larghezza (width) specificate nei CSS.

<textarea rows="10" cols="30" name="textarea">Questo è un testo di prova</textarea>


<time>...</time>

Il tag <time>, che evidenzia la presenza di una data o di un'altra indicazione temporale, per finalità semantiche.

<time datetime="2018-01-01 00:00">Capodanno</time>

<title>...</title>

Il tag <title>, definisce il titolo del documento, deve essere obbligatoriamente presente in tutti i documenti HTML.
Il suddetto titolo, ovvero la corrispondente stringa, verrà impiegata in tutti i contesti in cui occorre far riferimento alla pagina Web, in particolare come titolo mostrato nella barra degli strumenti del browser, come identificativo della pagina nella lista dei preferiti e simili, ma anche come titolo della pagina nei risultati restituiti dai motori di ricerca.

<track>...</track>

Gli elementi <track></track> consentono di selezionare le tracce delle rosorse multimediali.




<u>...</u>

Gli elementi <u></u> denotavano originariamente quelle porzioni di testo che dovevano essere sottolineate.
Nel contesto di HTML elementi <u></u> sono impiegati allo scopo di rappresentare delle porzioni di testo che "dovrebbero essere stilisticamente diverse dal testo normale", come le parole errate o simili.

<u>sottolineato</u>
sottolineato

<ul>...</ul>

Gli elementi <ul></ul> permettono di includere delle liste NON ordinate (un-ordered) all'interno della pagina Web.
Vedi anche <li></li> e <ol></ol>.

<var></var>

Gli elementi <var> vengono impiegati per evidenziare le parti di testo (che nei manuali tecnici) sono intese come variabili. Il tag è stato introdotto per finalità semantiche.

<var>Variabile</var>
Variabile

<video>...</video>

L'elemento <video> individua una risorsa corrispondente ad una registrazione video rendendola fruibile, rendendo disponibile una interfaccia utente costituita di pulsanti di start, stop, regolazione del volume, eccetera.
L'attributo poster consente di selezionare un immagine fissa da usare come "manifesto" di presentazione del video.

<video poster="Elementi_HTML_files/video.jpg" controls="controls" width="50%;">
  <source src="Elementi_HTML_files/video.mp4" type="video/mp4">
  Your browser does not support HTML5 video.
</video>


<wbr>

I tag <wbr> (Word Break Opportunity) consentono di evidenziare quei punti in cui potrebbe essere, eventualmente, possibile spezzare una stringa di caratteri molto lunga priva di interruzioni naturali (spazi, a capo, eccetera).

Esempio:
in assenza di indicazioni contrarie i browser tenteranno di scrivere ogni singola parola sulla stessa linea.
Introducendo i tag <wbr> si forza il browser ad andare a capo rendendo il testo più leggibile.

Esempio:
Random DNA Sequence results
random sequence 1 consisting of 1000 DNA bases.

ctgtacaaggtcctacaggattaagatctgaaaacttgagcagctattgcgcgcagcgcgacttgctaccagacagctttcttgatgtgttgggaaatagaaattactagactggatgctggttcaattgaaacctatcattaacttttttccctaggtggcctgacatacctgtcaagacttaagagttggctggctcatttttcctgggcgcagttggcacttcaaatagagagttacggatcattatcatttctaggtggtttatttccgtccaacgttcgctatacatgcagagaccgacttaattataagaactacgcggggcatagcctattgggcgtagtttgatagcttgctaggtgtttttagtaccaagtttccaccttctttgattaaaacaccctgagtggcttgagagcagtccgccaagggatggggtatagaacgataggcaccccggtattgcgtgaaagtatattatcgtggccttactttgtttaccacgtagaagagcatccgcgggcatatgagtaagcagtacccttagttgggtcggagcgaactcaggtcatgaacgaaagcgaaaccctgtgtgattttaaaatacgatttcaatacgctccgctgagtgccttgaaacattccgcgccacaccgcattggcacagaaggtcagcctgagctcggacctacatgtgagtatagcaacttgggccacaaacgcagtaggggcttagcacgacgatgtatgccagtatgaccacttcatgtttgctgaagggtagtaactgtgaggctgctggaatacaagctatgaacttcagagccaggtggcttatgatactgtggtagtgttaactatagattcgctatgcggatcacgggttcattcgtgggcgactttgtagggattgtggcgcgggacctattagatcacttgtgtggttaaatttgttcaccagctgctattcgaggtgttatcagagcgtaagacacgg

Bot
Bot = agenti informatici. Software capaci di sostituire gli uomini eseguendo analisi automatiche di grandi moli di dati.

Default
Valore utilizzato nel caso in cui l'operatore non specifichi nessuna opzione più specifica.

Finalità semantiche
Gli elementi introdotti per finalità semantiche sono elementi introdotti per migliorare la leggibilità del testo da parte dei Bot.

Risorse

Per risorsa si intende un qualsiasi manufatto informatico attivo o passivo (programmi, pagine HTML, file CSS, immagini, eccetera).
>